Electra Vector System IconElectra Vector System®
Simple, IP-Free©, scarless cloning in bacterial, mammalian and yeast expression vectors. DNA2.0 has developed a simple one-tube universal cloning process that can be performed in a 5 minute bench-top reaction. Available for Gene Synthesis orders and from the DNA2.0 vector catalog.

Feature Electra® Gibson® Gateway®
Reaction Time 5 min 15 min 1 – 16 hours
ORF into multiple vectors Yes No Yes
Cloning Ends Scarless   Scarless Scars
Licensing IP-Free License License
PCR Products Yes
Clean-up NOT required
Yes,
Clean-up recommended
Yes,
Clean-up required
Ready-to-use Vectors Yes No Yes
Single Reagent Kit Yes Yes No
Cost $ $ $$$

Or see
Cloning System
E. coli Marker
more
E. coli Copy
Expression Marker
more
Promoter
more
Propagation
RBS
Fusion
more
Expression Monitoring
more
Secretion Leader
more
Genome Editing
Catalog Vectors Use For Replication host Expression host Add to favorites
for Gene Synthesis
Number Name Cloning Control Properties Properties Add to cart
Electra
Electra     Electra Reagents Kit
EKT-02 Reagents Kit
Electra
Electra     PheS Counter-selection Mothers
pM265 PheS Elec M zeo, high copy
pM268 PheS Elec M amp, high copy
pM269 PheS Elec M chlor, high copy
pM275 PheS Elec M zeo, low copy
pM278 PheS Elec M amp, low copy
pM279 PheS Elec M chlor, low copy
Electra     rpsL Counter-selection Mothers
pM262 rpsL Elec M zeo, high copy
pM263 rpsL Elec M chlor, high copy
pM264 rpsL Elec M amp, high copy
pM272 rpsL Elec M zeo, low copy
pM273 rpsL Elec M chlor, low copy
pM274 rpsL Elec M amp, low copy
Electra     IP-Free T5 Electra Daughters
pD441-SR T5-sRBS-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS
pD441-MR T5-mRBS-ORF
Ecoli-Elec D
kan, high copy T5, med RBS
pD441-WR T5-wRBS-ORF
Ecoli-Elec D
kan, high copy T5, weak RBS
pD441-CF T5-ORF-FLAG
Ecoli-Elec D
kan, high copy T5, strong RBS, ORF-FLAG
pD441-CH T5-ORF-His
Ecoli-Elec D
kan, high copy T5, strong RBS, ORF-His
pD441-CC T5-ORF-GFP
Ecoli-Elec D
kan, high copy T5, strong RBS, ORF-GFP
pD441-NF T5-FLAG-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, FLAG-ORF
pD441-NH T5-His-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, His-ORF
pD441-NC T5-GFP-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, GFP-ORF
pD441-SSKT E.coli Secretion Signal Kit
T5-SS-ORF(Kan, 5 vectors)
kan, high copy T5, strong RBS, gIII, mal, ompA, pelB, phoA
pD441-mal T5-mal-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, mal
pD441-gIII T5-gIII-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, gIII
pD441-ompA T5-ompA-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, ompA
pD441-pelB T5-pelB-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, pelB
pD441-phoA T5-phoA-ORF
Ecoli-Elec D
kan, high copy T5, strong RBS, phoA
pD444-SR T5-sRBS-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS
pD444-MR T5-mRBS-ORF
Ecoli-Elec D
amp, high copy T5, med RBS
pD444-WR T5-wRBS-ORF
Ecoli-Elec D
amp, high copy T5, weak RBS
pD444-CF T5-ORF-FLAG
Ecoli-Elec D
amp, high copy T5, strong RBS, ORF-FLAG
pD444-CH T5-ORF-His
Ecoli-Elec D
amp, high copy T5, strong RBS, ORF-His
pD444-CC T5-ORF-GFP
Ecoli-Elec D
amp, high copy T5, strong RBS, ORF-GFP
pD444-NF T5-FLAG-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, FLAG-ORF
pD444-NH T5-His-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, His-ORF
pD444-NC T5-GFP-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, GFP-ORF
pD444-SSKT E.coli Secretion Signal Kit
T5-SS-ORF(Amp, 5 vectors)
amp, high copy T5, gIII, mal, ompA, pelB, phoA
pD444-mal T5-mal-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, mal
pD444-gIII T5-gIII-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, gIII
pD444-ompA T5-ompA-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, ompA
pD444-pelB T5-pelB-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, pelB
pD444-phoA T5-phoA-ORF
Ecoli-Elec D
amp, high copy T5, strong RBS, phoA
pD421-SR T5-sRBS-ORF
Ecoli-Elec D
kan, low copy T5, strong RBS
pD421-MR T5-mRBS-ORF
Ecoli-Elec D
kan, low copy T5, med RBS
pD421-WR T5-wRBS-ORF
Ecoli-Elec D
kan, low copy T5, weak RBS
pD422-SR T5-sRBS-ORF
Ecoli-Elec D
zeo, low copy T5, strong RBS
pD422-MR T5-mRBS-ORF
Ecoli-Elec D
zeo, low copy T5, med RBS
pD422-WR T5-wRBS-ORF
Ecoli-Elec D
zeo, low copy T5, weak RBS
pD424-SR T5-sRBS-ORF
Ecoli-Elec D
amp, low copy T5, strong RBS
pD424-MR T5-mRBS-ORF
Ecoli-Elec D
amp, low copy T5, med RBS
pD424-WR T5-wRBS-ORF
Ecoli-Elec D
amp, low copy T5, weak RBS
pD421-CH T5-ORF-His
Ecoli-Elec D
kan, low copy T5, strong RBS, ORF-His
pD421-NH T5-His-ORF
Ecoli-Elec D
kan, low copy T5, strong RBS, His-ORF
pD422-CH T5-ORF-His
Ecoli-Elec D
zeo, low copy T5, strong RBS, ORF-His
pD422-NH T5-His-ORF
Ecoli-Elec D
zeo, low copy T5, strong RBS, His-ORF
pD424-CH T5-ORF-His
Ecoli-Elec D
amp, low copy T5, strong RBS, ORF-His
pD424-NH T5-His-ORF
Ecoli-Elec D
amp, low copy T5, strong RBS, His-ORF
Electra     IP-Free Rhamnose Electra Daughters
pD861 Rham-ORF
Ecoli-Elec D
kan, high copy rhamnose, strong RBS
pD861-SR Rham-sRBS-ORF
E.coli-ElecD
kan, high copy rhamnose, strong RBS
pD861-MR Rham-mRBS-ORF
E.coli-ElecD
kan, high copy rhamnose, med RBS
pD861-WR Rham-wRBS-ORF
E.coli-ElecD
kan, high copy rhamnose, weak RBS
pD861-CH Rham-ORF-His
Ecoli-Elec D
kan, high copy rhamnose, strong RBS, ORF-His
pD861-NH Rham-His-ORF
Ecoli-Elec D
kan, high copy rhamnose, strong RBS, His-ORF
pD861-mal Rham-mal-ORF
E.coli-ElecD
kan, high copy rhamnose, strong RBS, mal
pD861-PpiBT Rman-PpiBT-ORF
E.coli-ElecD
kan, high copy rhamnose, strong RBS, PpiBT
pD864 Rham-ORF
Ecoli-Elec D
amp, high copy rhamnose, strong RBS
pD864-SR Rham-sRBS-ORF
E.coli-ElecD
amp, high copy rhamnose, strong RBS
pD864-MR Rham-mRBS-ORF
E.coli-ElecD
amp, high copy rhamnose, med RBS
pD864-WR Rham-wRBS-ORF
E.coli-ElecD
amp, high copy rhamnose, weak RBS
pD864-mal Rham-mal-ORF
E.coli-ElecD
amp, high copy rhamnose, strong RBS, mal
pD871 Rham-ORF
Ecoli-Elec D
kan, med copy rhamnose, strong RBS
pD871-mal Rham-mal-ORF
E.coli-ElecD
kan, med copy rhamnose, strong RBS, mal
pD874 Rham-ORF
Ecoli-Elec D
amp, med copy rhamnose, strong RBS
pD874-mal Rham-mal-ORF
E.coli-ElecD
amp, med copy rhamnose, strong RBS, mal
pD881 Rham-ORF
Ecoli-Elec D
kan, low copy rhamnose, strong RBS
pD881-SR Rham-sRBS-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS
pD881-MR Rham-mRBS-ORF
E.coli-ElecD
kan, low copy rhamnose, med RBS
pD881-WR Rham-wRBS-ORF
E.coli-ElecD
kan, low copy rhamnose, weak RBS
pD881-SSKT Rhamnose Secretion Signal Kit (11 vectors)
Rham-SS-ORF
kan, low copy rhamnose, strong RBS, dsbA, gIII, mal, ompA, ompC, ompT, pelB, phoA, sufI, torA, torT
pD881-dsbA Rham-dsbA-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, dsbA
pD881-torT Rham-torT-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, torT
pD881-sufI Rham-sufI-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, sufI
pD881-torA Rham-torA-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, torA
pD881-gIII Rham-gIII-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, gIII
pD881-mal Rham-mal-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, mal
pD881-ompA Rham-ompA-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, ompA
pD881-ompC Rham-ompC-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, ompC
pD881-ompT Rham-ompT-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, ompT
pD881-pelB Rham-pelB-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, pelB
pD881-phoA Rham-phoA-ORF
E.coli-ElecD
kan, low copy rhamnose, strong RBS, phoA
pD881-PpiBT Rham-PpiBT-ORF
Ecoli-Elec D
kan, low copy rhamnose, strong RBS, PpiBT
pD881-YebF Rham-YebF-ORF
Ecoli-Elec D
kan, low copy rhamnose, strong RBS, YebF
pD884 Rham-ORF
Ecoli-Elec D
amp, low copy rhamnose, strong RBS
pD884-SR Rham-sRBS-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS
pD884-MR Rham-mRBS-ORF
E.coli-ElecD
amp, low copy rhamnose, med RBS
pD884-WR Rham-wRBS-ORF
E.coli-ElecD
amp, low copy rhamnose, weak RBS
pD884-SSKT Rhamnose Secretion Signal Kit (11 vectors)
Rham-SS-ORF
amp, low copy rhamnose, strong RBS, dsbA, gIII, mal, ompA, ompC, ompT, pelB, phoA, sufI, torA, torT
pD884-dsbA Rham-dsbA-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, dsbA
pD884-torT Rham-torT-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, torT
pD884-sufI Rham-sufI-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, sufI
pD884-torA Rham-torA-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, torA
pD884-gIII Rham-gIII-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, gIII
pD884-mal Rham-mal-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, mal
pD884-ompA Rham-ompA-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, ompA
pD884-ompC Rham-ompC-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, ompC
pD884-ompT Rham-ompT-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, ompT
pD884-pelB Rham-pelB-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, pelB
pD884-phoA Rham-phoA-ORF
E.coli-ElecD
amp, low copy rhamnose, strong RBS, phoA
Electra     IP-Free SV40/CMV Electra Daughters
pD600 CMV-ORF
Mamm-Elec D
amp, high copy CMV, SV40
pD602 CMV-ORF
Mamm-Elec D
amp, zeo, high copy zeo, CMV, SV40
pD603 CMV-ORF
Mamm-Elec D
amp, high copy neo, CMV, SV40
pD607 CMV-ORF
Mamm-Elec D
amp, high copy hygro, CMV, SV40
pD608 CMV-ORF
Mamm-Elec D
amp, high copy blast, CMV, SV40
pD609 CMV-ORF
Mamm-Elec D
amp, high copy puro, CMV, SV40
pD610 CMV-ORF
CMV-ORF
amp, low copy CMV, SV40
pD612 CMV-ORF
Mamm-Elec D
amp, zeo, low copy zeo, CMV, SV40
pD613 CMV-ORF
Mamm-Elec D
amp, low copy neo, CMV, SV40
pD617 CMV-ORF
Mamm-Elec D
amp, low copy hygro, CMV, SV40
pD618 CMV-ORF
Mamm-Elec D
amp, low copy blast, CMV, SV40
pD619 CMV-ORF
Mamm-Elec D
amp, low copy puro, CMV, SV40
pD677-CC CMV-ORF-GFP
Mamm-Elec D
amp, high copy hygro, CMV, SV40, ORF-GFP
pD678-CC CMV-ORF-GFP
Mamm-Elec D
amp, high copy blast, CMV, SV40, ORF-GFP
pD679-CC CMV-ORF-GFP
Mamm-Elec D
amp, high copy puro, CMV, SV40, ORF-GFP
pD679-CD CMV-ORF-GFP
Mamm-ElecD
amp, high copy puro, CMV, SV40, ORF-Dasher
pD673-CRc CMV-ORF-RFPc
Mamm-ElecD
amp, high copy neo, CMV, SV40, ORF-Cayenne
pD677-NC CMV-GFP-ORF
Mamm-Elec D
amp, high copy hygro, CMV, SV40, GFP-ORF
pD678-NC CMV-GFP-ORF
Mamm-Elec D
amp, high copy blast, CMV, SV40, GFP-ORF
pD679-NC CMV-GFP-ORF
Mamm-Elec D
amp, high copy puro, CMV, SV40, GFP-ORF
pD679-ND CMV-GFP-ORF
Mamm-ElecD
amp, high copy puro, CMV, SV40, Dasher-ORF
pD673-NRc CMV-RFPc-ORF
Mamm-ElecD
amp, high copy neo, CMV, SV40, Cayenne-ORF
pD657-RA CMV-RFP-2A-ORF
Mamm-Elec D
amp, high copy hygro, CMV, SV40, RFP-2A-ORF
pD653-RcA CMV-RFPc-2A-ORF
Mamm-ElecD
amp, high copy neo, CMV, SV40, Cayenne-2A-ORF
pD659-CA CMV-GFP-2A-ORF
Mamm-Elec D
amp, high copy puro, CMV, SV40, GFP-2A-ORF
pD668-AC CMV-ORF-2A-GFP
Mamm-Elec D
amp, high copy blast, CMV, SV40, ORF-2A-GFP
pD663-ARc CMV-ORF-2A-RFPc
Mamm-ElecD
amp, high copy neo, CMV, SV40, ORF-2A-Cayenne
pD669-AR CMV-ORF-2A-RFP
Mamm-Elec D
amp, high copy puro, CMV, SV40, ORF-2A-RFP
pD643-Rc CMV-ORF-IRES-RFPc
Mamm-ElecD
amp, high copy neo, CMV, SV40, ORF-IRES-Cayenne
pD647 CMV-ORF-IRES-GFP
Mamm-ElecD
amp, high copy hygro, CMV, SV40, ORF-IRES-GFP
pD648 CMV-ORF-IRES-GFP
Mamm-ElecD
amp, high copy blast, CMV, SV40, ORF-IRES-GFP
pD649 CMV-ORF-IRES-GFP
Mamm-ElecD
amp, high copy puro, CMV, SV40, ORF-IRES-GFP
pD649-D CMV-ORF-IRES-GFP
Mamm-ElecD
amp, high copy puro, CMV, SV40, ORF-IRES-Dasher
pD607-NLS CMV-NLS-ORF
Mamm-Elec D
amp, high copy hygro, CMV, SV40
pD608-NLS CMV-NLS-ORF
Mamm-Elec D
amp, high copy blast, CMV, SV40
pD609-NLS CMV-NLS-ORF
Mamm-Elec D
amp, high copy puro, CMV, SV40
pD607-CAAX CMV-ORF-CAAX
Mamm-Elec D
amp, high copy hygro, CMV, SV40
pD608-CAAX CMV-ORF-CAAX
Mamm-Elec D
amp, high copy blast, CMV, SV40
pD609-CAAX CMV-ORF-CAAX
Mamm-Elec D
amp, high copy puro, CMV, SV40
Electra     Lentivirus/EF1a Electra Daughters
pD1117 EF1a-ORF
Lenti-ElecD
kan, high copy hygro, EF1α, Lentivirus
pD1118 EF1a-ORF
Lenti-ElecD
kan, high copy blast, EF1α, Lentivirus
pD1119 EF1a-ORF
Lenti-ElecD
kan, high copy puro, EF1α, Lentivirus
Electra     Cas9 Electra Daughters
pD1301 CMV-Cas9
Cas9-ElecD
kan, high copy CMV, Cas9
pD1311 CBh-Cas9
Cas9-ElecD
kan, high copy CBh, Cas9
pD1301-AD CMV-Cas9-2A-GFP
Cas9-ElecD
kan, high copy CMV, Cas9-2A-Dasher, Cas9
pD1311-AD CBh-Cas9-2a-GFP
Cas9-ElecD
kan, high copy CBh, Cas9-2A-Dasher, Cas9
pD1321-AD CAG-Cas9-2A-GFP
Cas9-ElecD
kan, high copy CAG, Cas9-2A-Dasher, Cas9
pD1301-AP CMV-Cas9-2A-RFP
Cas9-ElecD
kan, high copy CMV, Cas9-2A-Paprika, Cas9
pD1311-AP CBh-Cas9-2A-RFP
Cas9-ElecD
kan, high copy CBh, Cas9-2A-Paprika, Cas9
pD1321-AP CAG-Cas9-2a-RFP
Cas9-ElecD
kan, high copy CAG, Cas9-2A-Paprika, Cas9
Electra     Cas9 Nickase Electra Daughters
pD1401 CMV-Cas9N
Cas9-ElecD
kan, high copy CMV, Cas9 Nickase
pD1411 CBh-Cas9N
Cas9-ElecD
kan, high copy CBh, Cas9 Nickase
pD1401-AD CMV-Cas9N-2A-GFP
Cas9-ElecD
kan, high copy CMV, Cas9-2A-Dasher, Cas9 Nickase
pD1411-AD CBh-Cas9N-2A-GFP
Cas9-ElecD
kan, high copy CBh, Cas9-2A-Dasher, Cas9 Nickase
pD1421-AD CAG-Cas9N-2A-GFP
Cas9-ElecD
kan, high copy CAG, Cas9-2A-Dasher, Cas9 Nickase
pD1401-AP CMV-Cas9N-2A-RFP
Cas9-ElecD
kan, high copy CMV, Cas9-2A-Paprika, Cas9 Nickase
pD1411-AP CBh-Cas9N-2A-RFP
Cas9-ElecD
kan, high copy CBh, Cas9-2A-Paprika, Cas9 Nickase
pD1421-AP CAG-Cas9N-2A-RFP
Cas9-ElecD
kan, high copy CAG, Cas9-2A-Paprika, Cas9 Nickase
Electra     IP-Free Pichia Electra Daughters: AOX cytoplasmic
pD902 AOX-ORF
Pichia-Elec D
zeo, high copy zeo, AOX
Electra     IP-Free Pichia Electra Daughters: AOX secreted
pD912 AOX-alpha-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, alphafactor_full
pD912-SSKT Pichia Secretion Signal Kit (10 vectors)
AOX-SS-ORF
zeo, high copy AOX, a-amylase, alphafactor_full, alphafactor_K, alphafactor_KS, alphafactor_T, glucoamylase, inulinase, invertase, killer protein, lysozyme, serum albumin
pD912-AA AOX-aAmylase-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, a-amylase
pD912-AK AOX-alphaK-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, alphafactor_K
pD912-AKS AOX-alphaKS-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, alphafactor_KS
pD912-AT AOX-alphaT-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, alphafactor_T
pD912-GA AOX-Glucoamyl-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, glucoamylase
pD912-IN AOX-Inulinase-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, inulinase
pD912-IV AOX-Invertase-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, invertase
pD912-KP AOX-Killerpro-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, killer protein
pD912-LZ AOX-Lysozyme-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, lysozyme
pD912-SA AOX-Albumin-ORF
Pichia-Elec D
zeo, high copy zeo, AOX, serum albumin
Electra     IP-Free Saccharomyces 2µ Electra Daughters
pD1201 GAL1-ORF
S.cer-Elec D
kan, high copy Leu2, GAL1
pD1204 GAL1-ORF
S.cer-Elec D
amp, high copy Ura3, GAL1
pD1204-NSH GAL1-STREP-HIS-ORF
S.cer-Elec D
amp, high copy Ura3, GAL1, His-ORF
pD1204-NHA GAL1-HA(3)-ORF
S.cer-Elec D
amp, high copy Ura3, GAL1, HA-ORF
pD1205 GAL1-ORF
S.cer-Elec D
chlor, high copy Trp1, GAL1
pD1207 GAL1-ORF
S.cer-Elec D
kan, high copy His3, GAL1
pD1211 TEF-ORF
S.cer-Elec D
kan, high copy Leu2, TEF
pD1214 TEF-ORF
S.cer-Elec D
amp, high copy Ura3, TEF
pD1214-SSKT S. cer Secretion signal kit
TEF-SS-ORF (11 vectors)
amp, high copy Ura3, TEF, a-amylase, alphafactor_full, alphafactor_K, alphafactor_KS, alphafactor_T, glucoamylase, inulinase, invertase, killer protein, lysozyme, serum albumin
pD1214-FAKS TEF-Fullalpha-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, alphafactor_full
pD1214-AKS TEF-alphaKS-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, alphafactor_KS
pD1214-AK TEF-alphaK-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, alphafactor_K
pD1214-AT TEF-alphaT-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, alphafactor_T
pD1214-AA TEF-aAmylase-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, a-amylase
pD1214-GA TEF-Glucoamyl-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, glucoamylase
pD1214-IN TEF-Inulinase-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, inulinase
pD1214-IV TEF-Invertase-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, invertase
pD1214-KP TEF-Killerpro-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, killer protein
pD1214-LZ TEF-Lysozyme-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, lysozyme
pD1214-SA TEF-Albumin-ORF
S. cer-ElecD
amp, high copy Ura3, TEF, serum albumin
pD1215 TEF-ORF
S.cer-Elec D
chlor, high copy Trp1, TEF
pD1217 TEF-ORF
S.cer-Elec D
kan, high copy His3, TEF
pD1221 ADH-ORF
S.cer-Elec D
kan, high copy Leu2, ADH
pD1221-SSKT S. cer Secretion signal kit
ADH-SS-ORF (11 vectors)
kan, high copy Leu2, ADH, a-amylase, alphafactor_full, alphafactor_K, alphafactor_KS, alphafactor_T, glucoamylase, inulinase, invertase, killer protein, lysozyme, serum albumin
pD1221-FAKS ADH-Fullalpha-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, alphafactor_full
pD1221-AKS ADH-alphaKS-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, alphafactor_KS
pD1221-AK ADH-alphaK-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, alphafactor_K
pD1221-AT ADH-alphaT-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, alphafactor_T
pD1221-AA ADH-aAmylase-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, a-amylase
pD1221-GA ADH-Glucoamyl-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, glucoamylase
pD1221-IN ADH-Inulinase-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, inulinase
pD1221-IV ADH-Invertase-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, invertase
pD1221-KP ADH-Killerpro-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, killer protein
pD1221-LZ ADH-Lysozyme-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, lysozyme
pD1221-SA ADH-Albumin-ORF
S. cer-ElecD
kan, high copy Leu2, ADH, serum albumin
pD1224 ADH-ORF
S.cer-Elec D
amp, high copy Ura3, ADH
pD1225 ADH-ORF
S.cer-Elec D
chlor, high copy Trp1, ADH
pD1227 ADH-ORF
S.cer-Elec D
kan, high copy His3, ADH
pD1231 GPD-ORF
S.cer-Elec D
kan, high copy Leu2, GPD
pD1234 GPD-ORF
S.cer-Elec D
amp, high copy Ura3, GPD
pD1235 GPD-ORF
S.cer-Elec D
chlor, high copy Trp1, GPD
pD1237 GPD-ORF
S.cer-Elec D
kan, high copy His3, GPD
Paintbox
Paintbox     IP-Free E. coli Paintbox Electra Mothers: Fluorescent
FPB-20E-269 CindyLou
CFP
chlor, high copy
FPB-21E-269 Frosty
CFP
chlor, high copy
FPB-23E-269 Marley
YFP
chlor, high copy
FPB-24E-269 Cratchit
YFP
chlor, high copy
FPB-48E-269 Kringle
YFP
chlor, high copy
FPB-26E-269 Comet
GFP
chlor, high copy
FPB-27E-269 Dasher
GFP
chlor, high copy
FPB-28E-269 Ivy
GFP
chlor, high copy
FPB-29E-269 Holly
GFP
chlor, high copy
FPB-30E-269 Yukon
OFP
chlor, high copy
FPB-31E-269 Rudolph
RFP
chlor, high copy
FPB-47E-269 Twinkle
CFP
chlor, high copy
FPB-54E-269 Fresno
RFP
chlor, high copy
FPB-55E-269 Cayenne
RFP
chlor, high copy
FPB-56E-269 Paprika
RFP
chlor, high copy
FPB-57E-269 Serrano
RFP
chlor, high copy
Paintbox     IP-Free E. coli Paintbox Electra Mothers: Color
CPB-33E-269 Blitzen
Blue
chlor, high copy
CPB-34E-269 Dreidel
Teal
chlor, high copy
CPB-35E-269 Virginia
Violet
chlor, high copy
CPB-36E-269 Vixen
Purple
chlor, high copy
CPB-37E-269 Prancer
Purple
chlor, high copy
CPB-38E-269 Tinsel
Purple
chlor, high copy
CPB-39E-269 Maccabee
Purple
chlor, high copy
CPB-40E-269 Donner
Magenta
chlor, high copy
CPB-41E-269 Cupid
Pink
chlor, high copy
CPB-44E-269 Seraphina
Pink
chlor, high copy
CPB-45E-269 Scrooge
Orange
chlor, high copy
CPB-46E-269 Leor
Orange
chlor, high copy
Paintbox     IP-Free Yeast Paintbox Electra Mothers: Fluorescent
FPB-27Y-265 Dasher
GFP
zeo, high copy
FPB-23Y-265 Marley
YFP
zeo, high copy
FPB-51P-265 Simeon
OFP
zeo, high copy
FPB-31P-265 Rudolph
RFP
zeo, high copy
FPB-48P-265 Kringle
YFP
zeo, high copy
FPB-27Y-269 Dasher
GFP
chlor, high copy
FPB-23Y-269 Marley
YFP
chlor, high copy
FPB-31Y-269 Rudolph
RFP
chlor, high copy
FPB-52P-265 TinyTim
OFP
zeo, high copy
FPB-48P-269 Kringle
YFP
chlor, high copy
FPB-52Y-269 TinyTim
OFP
chlor, high copy
FPB-51Y-269 Simeon
OFP
chlor, high copy
Paintbox     IP-Free Mammalian Paintbox Electra Mothers
FPB-26H-269 Comet
GFP
chlor, high copy
FPB-27H-269 Dasher
GFP
chlor, high copy
FPB-30H-269 Yukon
OFP
chlor, high copy
FPB-31H-269 Rudolph
RFP
chlor, high copy
FPB-59H-269 Partridge
CFP
chlor, high copy
FPB-60H-269 Snow
CFP
chlor, high copy
FPB-54H-269 Fresno
RFP
chlor, high copy
FPB-55H-269 Cayenne
RFP
chlor, high copy
FPB-56H-269 Paprika
RFP
chlor, high copy
FPB-57H-269 Serrano
RFP
chlor, high copy
FPB-58H-269 Santaka
RFP
chlor, high copy
Paintbox     IP-Free E. coli Paintbox T5: Biobricks fluorescent
FPB-32E-269 Tannen
RFP
chlor, high copy
FPB-BB1-269 Eira
CFP
chlor, high copy
FPB-BB2-269 Juniper
GFP
chlor, high copy
FPB-BB3-269 Blaze
YFP
chlor, high copy

Electra Advantages:

Easy – 1 tube, 5 minute reaction

Universal – any ORF cloned into any Electra vector. Quickly move ORFs from MOTHER vector to multiple DAUGHTER vectors

Scarless – always in frame with no nucleotide scars

IP-Free – No license, no royalty share, no restrictions

Choice – Large selection of vectors for multiple hosts with fusions, bicistronic expression, promoters, RBSs, and more

Convenient – clone your genes using the Electra Cloning kit, or have DNA2.0 do the work for you

Electra System Process diagram

DNA2.0 has developed a simple, one-tube, universal cloning process that can be performed in a 5 minute bench-top reaction with the fidelity of a restriction based cloning system. The Electra system uses the type IIS restriction enzyme SapI, which recognizes a 7bp non-palindromic recognition sequence and leaves a 3bp 5’ overhang after digestion. We have developed a collection of IP-Free bacterial, mammalian and yeast expression vectors that provide a quick and efficient way to test a gene of interest under control of various elements and are available with optional C- and N-terminal tags and/or fusions. Any vector can be easily “Electra-fied” (converted to function as an Electra vector), and DNA2.0 will assist anyone who wishes to do so.

Electra System Mother and Daughter Vectors

Efficient transfer of your ORF into multiple expression vectors with varying features using the DNA2.0 Electra system. An ORF of interest (Gene A) can be easily transferred from the mother vector (pMOTHER) into a range of DAUGHTER vectors (pDAUGHTERs). DAUGHTER vectors are available in Bacterial, Mammalian and Yeast vectors with your choice of resistance markers, fluorescent protein stuffers and C- and N-terminal tags and/or fusions.

Notes: Gibson Assembly® is a registered trademark of Synthetic Genomics, Inc.; Gateway® is a registered trademark of Invitrogen, Inc..

The Electra system uses the type IIS restriction enzyme SapI. SapI recognizes a 7bp non-palindromic recognition sequence and cuts outside of the recognition sequence, leaving a 3bp 5’ overhang after digestion. ORFs in a pMOTHER vector can be excised with SapI, resulting in ATG and GGT overhangs. Alternatively, PCR can be used to generate ORFs with the correct overhangs. These ORFs can then be easily cloned into pDAUGHTER vectors, which are provided linearized with the corresponding overhangs.

pMOTHER type IIs sites:

Electra System pMOTHER cloning ends

 

 

pDAUGHTER Overhangs (linearized vector):

Electra System pDAUGHTER cloning ends

pDAUGHTER vectors are provided linearized with compatible ends, and do NOT contain SapI sites.

To determine the time course and selectivity of a standard Electra reaction.

  • pMOTHER constructs: a yellow fluorescent protein gene (KringleYFP) was cloned into two pMOTHER vectors:
    1. pMOTHER264 – pUC bacterial origin, Amp resistance, rpsL counter-selection marker
    2. pMOTHER268 – pUC bacterial origin, Amp resistance, PheS counter-selection marker
  • SapI-linearized pDAUGHTER vector:
    &nbsp pDAUGHTER 441-SR (inducible T5 promoter, strong RBS, Kan resistance, pUC bacterial origin)

Methods:

  1. Reactions for the exchange of ORF from pMOTHER vectors to pDAUGHTER vector were set up in a single 1.5ml tube as follows:
    Component Volume (µl)
    Total Volume 20
    Mother Vector (30ng final) 3
    Daughter Vector (3 ng final) 1
    Electra Buffer Mix (1X) 2
    Electra Enzyme Mix (1X) 1
    ddH2O 13
  2. Reactions were incubated for 5, 10, 20, 40 or 60 minutes at room temperature.
  3. 2.5 µl of each reaction was transformed into 50 µl of NEB 10-beta Competent E. coli and 100 µl of each transformation was plated onto LB Agar plates with 30 µg/mL kanamycin alone or with kanamycin and 100 µg/mL streptomycin or YEG (phenylalanine analog).
  4. 48 transformants were picked from both the kanamycin alone and kanamycin + streptomycin or chloro –phenylalanine plates for each of the MOTHER/DAUGHTER combinations and sequence verified. Greater than 95% of the transformants had the correct insert.

Results:

Time Course of Electra reaction:
CFU/100µl 1:100 dilution plated
LB+Kan
CFU/100µl 1:100 dilution plated
LB+Kan+Strep         YEG+kan+chloro-phe
Time pM264 x pDAUGHTER (T5) pM268 x pDAUGHTER (T5) pM264 x pDAUGHTER (T5) pM264 x pDAUGHTER (T5)
5min 35 18 39 21
10min 87 67 115 68
20min 252 202 332 222
40min 423 381 432 421
60min 383 367 380 363
Electra System Time Course

Electra system cloning time course with E. coli pDAUGHTER expression vectors. A gene encoding KringleYFP was cloned into an ampicillin-resistant pMOTHER vector with an rpsL counter-selection gene (pMOTHER264, left panel) or a PheS counter-selection gene (pMOTHER268, right panel). The pMOTHER vectors were mixed with a pre-linearized E. coli pDAUGHTER expression vector with inducible T5 promoter (pDAUGHTER441-SR) in the presence of SapI, T4 DNA ligase and ATP. Reaction mixtures were transformed into E. coli NEB 10-beta Competent E. coli cells after various reaction times, and plated onto nutrient agar with kanamycin (blue lines) or kanamycin plus MOTHER counter-selection agent (red lines).

These results show that incubation of MOTHER DNA, DAUGHTER DNA, type IIs restriction enzyme SapI and T4 DNA ligase in a single tube results in the exchange and stable propagation of the yellow fluorescent protein fragment from the pMOTHER vector to the pDAUGHTER vector in as little as 5 minutes and the reaction is complete by 40 min at 25°C.

Summary:

A pMOTHER vector carrying a gene encoding KringleYFP (yellow fluorescent protein) was mixed with an E. coli expression pDAUGHTER vector in the presence of Electra Reagent Mix for between 5 and 60 minutes. Reactions were transformed into competent cells and plated onto LB agar plates supplemented with appropriate selective antibiotics.

Reactions give transformants in as little as 5 minutes and are complete by 40 minutes. Almost all transformants showed an inducible fluorescent yellow phenotype, indicating accurate movement of the gene from the pMOTHER into the expression pDAUGHTER vectors. DAUGHTER constructs are selected because MOTHER and DAUGHTER vectors use different antibiotic resistance markers.

Since MOTHER and DAUGHTER are present in the transformation mixture, a fraction of the cells transformed with a DAUGHTER construct will also take up and maintain the MOTHER construct. MOTHER vectors therefore also carry a counter-selection marker, either rpsL (streptomycin sensitivity) or PheS (phenylalanine analog p-chlorophenylalanine sensitivity). Plating transformants onto media that contains both DAUGHTER selection antibiotic and MOTHER counter-selection agent reduces (rpsL) or completely eliminates (PheS) transformants that carry the MOTHER.

To determine if it is possible to clone a PCR product without any prior treatment or cleanup, into a pDAUGHTER vector using the Electra one tube reaction approach described above.

Methods:

  1. A yellow fluorescent protein (KringleYFP) was amplified by PCR using primers:
    107888A-ampF
    TACACGTACTTAGTCGCTGAAGGGGAAGTCTTCGCTCTTCTATGACGGCACTGACTGAAGGCGCAAAACTGTTCGAG
    107888A-ampR
    AGGTACGAACTCGATTGACGTTTTTAGTCTTCGCTCTTCTACCTTAACGGTACGTTTCCAGGTCAACTGCCTTGATC
  2. 5 µl of each reaction was run on a 1% agarose-TBE gel. A strong and clean amplicon running at 750 bp was observed with an estimated concentration of 100ng/µl.
  3. Electra cloning of PCR product into a pDAUGHTER vector was carried out as a one tube reaction using 2 ng of linearized pDAUGHTER vector, 200 ng of PCR reaction and incubation time of 5 minutes at room temperature.
  4. 2.5 µl of each reaction was transformed into 50 µl of NEB 10-beta Competent E. coli and 100 µl of each transformation was plated.

Results:

We observed thousands of yellow colonies with less than 5% white colonies with no insert. The results demonstrate that crude PCR product can be cloned into a pDAUGHTER vector in 5 minutes at room temperature without any PCR reaction treatment or cleanup. It will therefore be possible to PCR amplify a gene of interest and efficiently clone the PCR product into any DAUGHTER vector. PCR allows for efficient transfer of an open reading frame of interest into a variety of host expression systems using the Electra cloning system and DNA2.0′s DAUGHTER expression vectors.

To determine expression levels from a variety of E. coli secretion signals using Electra daughter vectors. This experiment shows that it is simple and effective to transfer an ORF from a single mother vector into multiple daughter vectors, allowing one to compare and optimize expression levels.

Figure: Expression of Cutinase in pD441 Electra Vector with Various Secretion Signals

Figure: Expression of Cutinase in pD441 Electra Vector with Various Secretion Signals.  Four transformants per construct in E. coli BL21 cells were grown at 37°C in 2 ml LB + 30 µg/ml kanamycin to an OD600 of 0.8.  Cultures were induced by addition of 1mM IPTG and incubated for 3 hrs at 37°C; uninduced cultures were run as negative controls.  Samples were pelleted and periplamic preps prepared.  Total protein samples and periplasmic fractions were denatured and reduced in sample buffer with reducing agent at 95°C for 10min.  5µl of denatured sample was loaded per lane of a 4-12% NuPAGE Bis-Tris MES gel and Coomasie stained.  As observed from the gels (panels A, B and C), there are clear differences in expression and processing of the cutinase protein with different secretion signals seen in the periplasmic fractions (shown by arrows).  The highest expression levels of cutinase in the periplasmic fractions were observed with secretion signal mal (panel C, left) with no uncleaved higher mol. wt. bands.  Secretion signals pelB (panel A, right) and ompA (panel B, right) showed lower levels of cutinase expression with some higher mol. wt. bands indicating incomplete processing.

Component Volume (µl)
Total Volume 20
Mother Vector DNA or PCR product (20 ng final) 1
Daughter Vector (20 ng final) 1
Electra Buffer Mix* (1X) 2
Electra Enzyme Mix* (1X) 1
Sterile ddH2O 15
*From the Electra Cloning Kit
  1. Combine components as listed in table above in a single 1.5ml tube. Note Daughter Vectors come pre-linearized from DNA2.0.
  2. Incubate 5 – 20 minutes at room temperature.
  3. Transform 2 µl of each reaction into competent cells. Note cells used at DNA2.0 are streptomycin resistant cell lines.
  4. Plate onto LB plates with selection antibiotic alone,
    or with selection antibiotic and 100 µg/mL streptomycin (Teknova #L1148 Kan+strep),
    or YEG plates with selection antibiotic and 16mM p-chloro-phenylalanine (Teknova #Y5700 (Kan+chloro-phe) or #Y5705 (Amp+chloro-phe)). (Protocol for making pheS or rpsL plates)
  5. Incubate overnight at 37°C.

To PCR your ORF: we recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into Electra vectors. Add 15-20 bp of your ORF to the 3′ primer end to amplify your ORF and have it compatible with any of the Electra MOTHER or Electra DAUGHTER expression vectors.

  • Forward primer with ATG start codon on primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTATG….(ORF beginning after ATG start codon)….
  • Reverse primer:
    5′-AGGTACGAACTCGATTGACGGCTCTTCTACC….(ORF Reverse Complement)….

Additional Info

A PCR mixture can be directly cloned into pMOTHER or pDAUGHTER vectors using the Electra reagents. However, if your PCR reaction shows multiple bands by gel analysis, it is very likely that some fragments other than your gene of interest will also contain SapI ends and may be cloned into your Electra vector. Additional screening of colonies will be useful to identify clones containing your gene of interest.

Your ORF must NOT contain any SapI recognition sites, as the Electra cloning process utilizes the type IIs enzyme SapI

Use the DNA2.0 Bioinformatics Toolbox to facilitate primer analysis and design.

A PDF of this protocol can be found here.PDF image
A PDF to make PheS or rpsL plates can be found here.PDF image

“Electra-fy” Your Vector

DNA2.0 can modify almost any cloning or expression vector into an Electra Vector. Your favorite vector can then be used with the Electra system to quickly and efficiently transfer genes. Of course, your vectors remain your property, and the entire system is IP-Free.

Consult with an Electra Specialist today at +1 877 362 8646 or info@DNA20.com to learn more about improving your cloning and expression system.

Learn more about the Electra Vector System and how it can benefit your research with this webinar featuring Medini Gore, Electra Project Manager.
View a pdf of webinar slides.

“Nothing like adding a little more tragedy to science!” – Dr. Aaron Straight, Stanford University

True, science can occasionally feel like a Greek tragedy. We named our new cloning system ‘Electra’ because it allows you to select against the pMOTHER vector just as Electra destroyed her own mother Clytemnestra. Hopefully, your endeavours are more successful than those of Antigone. Thankfully, unlike the original Electra, your selection of the daughter against the mother will not require any atonement to the gods.

Learn more about the classic Greek tragedy Electra:
Electra story – Euripedes version
Electra story – Sophocles version

DNA2.0 has created a line of products designated “IP-Free”. These products do not require any licensing, do not have royalty shares and do not have restrictions on downstream use. Sure, our lawyers put in a bit of reasonable legal fine print (you can’t resell the exact same product, you can’t use it for direct competition, you have to give us some acknowledgement, etc…); but other than that, we really do mean that these products are completely IP-Free. For example, you can use them in your research or create products to which you own all the rights.
See the complete legal IP-Free Terms and Conditions
DNA2.0 has patent applications filed for the Electra cloning system using the type IIs enzyme SapI, and holds all rights for the system.
Yes! See the protocol for all the necessary info, including primers and design. You can clone your PCR product into any pMOTHER or pDAUGHTER vector.

To PCR your ORF: we recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into Electra vectors. Add 15-20 bp of your ORF to the 3′ primer end to amplify your ORF and have it compatible with any of the Electra MOTHER or Electra DAUGHTER expression vectors.

  • Forward primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTATG….(ORF)….
  • Reverse primer:
    5′-AGGTACGAACTCGATTGACGGCTCTTCTACC….(ORF Reverse Complement)….

Use the DNA2.0 Bioinformatics Toolbox to facilitate primer analysis and design.

Your ORF must NOT contain any SapI recognition sites, as the Electra cloning process utilizes the type IIs enzyme SapI

Easy, simply PCR out your ORF using the PCR primer ends shown below and clone into any Electra vector using the standard protocol.

To PCR your ORF we recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into Electra vectors. Add 15-20 bp of your ORF to the 3′ primer end to amplify your ORF and have it compatible with any of the Electra MOTHER or Electra DAUGHTER expression vectors.

  • Forward primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTATG….(ORF)….
  • Reverse primer:
    5′-AGGTACGAACTCGATTGACGGCTCTTCTACC….(ORF Reverse Complement)….

Use the DNA2.0 Bioinformatics Toolbox to facilitate primer analysis and design.

Your ORF must NOT contain any SapI recognition sites, as the Electra cloning process utilizes the type IIs enzyme SapI

Yes! You can use the Electra reagents kit for all Electra cloning reactions.
Easy, DNA2.0 can modify almost any cloning or expression vector into an Electra Vector. Your favorite vector can then be used with the Electra system to quickly and efficiently transfer genes. Of course, your vectors remain your property, and the entire system is IP-Free.

Consult with an Electra Specialist today at +1 877 362 8646 or info@DNA20.com to learn more about improving your cloning and expression system.

Please note: the Electra Vector System is currently available to ship only to customers in the US, Canada, Japan, and major European hubs.
Electra System international shipping is available to European locations from our EU distributor, Cambridge Bioscience, Ltd.
Electra System international shipping is available to Japanese locations from our distributor, Cosmo Bio Co, Ltd.

Gene Synthesis Cloning orders in the Electra System are available for all customers worldwide.

Yes.

A PDF to make PheS or rpsL plates can be found here.PDF image

You can also order plates from Teknova:
Selection antibiotic and 100 µg/mL streptomycin (Teknova #L1148 Kan+strep)
YEG plates with selection antibiotic and 16mM p-chloro-phenylalanine (Teknova #Y5700 (Kan+chloro-phe) or #Y5705 (Amp+chloro-phe))