Electra Vector System

One tube. Five Minutes. Any ORF.

Feature Electra® Gibson® Gateway®
Reaction Time 5 min 15 min 1 – 16 hours
ORF into multiple vectors Yes No Yes
Cloning Ends Scarless   Scarless Scars
Licensing IP-Free License License
PCR Products Yes
Clean-up NOT required
Yes,
Clean-up recommended
Yes,
Clean-up required
Ready-to-use Vectors Yes No Yes
Single Reagent Kit Yes Yes No
Cost $ $ $$$

Electra Advantages

Easy – 1 tube, 5 minute reaction

Universal – any ORF cloned into any Electra vector. Quickly move ORFs from MOTHER vector to multiple DAUGHTER vectors

Scarless – always in frame with no nucleotide scars

IP-Free – No license, no royalty share, no restrictions

Choice – Large selection of vectors for multiple hosts with fusions, bicistronic expression, promoters, RBSs, and more

Convenient – clone your genes using the Electra Cloning kit, or have DNA2.0 do the work for you


Electra System Process diagram

DNA2.0 has developed a simple, one-tube, universal cloning process that can be performed in a 5 minute bench-top reaction with the fidelity of a restriction based cloning system. The Electra system uses the type IIS restriction enzyme SapI, which recognizes a 7bp non-palindromic recognition sequence and leaves a 3bp 5’ overhang after digestion. We have developed a collection of IP-Free bacterial, mammalian and yeast expression vectors that provide a quick and efficient way to test a gene of interest under control of various elements and are available with optional C- and N-terminal tags and/or fusions. Any vector can be easily “Electra-fied” (converted to function as an Electra vector), and DNA2.0 will assist anyone who wishes to do so.

Electra System Mother and Daughter Vectors

Efficient transfer of your ORF into multiple expression vectors with varying features using the DNA2.0 Electra system. An ORF of interest (Gene A) can be easily transferred from the mother vector (pMOTHER) into a range of DAUGHTER vectors (pDAUGHTERs). DAUGHTER vectors are available in Bacterial, Mammalian and Yeast vectors with your choice of resistance markers, fluorescent protein stuffers and C- and N-terminal tags and/or fusions.

Notes: Gibson Assembly® is a registered trademark of Synthetic Genomics, Inc.; Gateway® is a registered trademark of Invitrogen, Inc..


Webinar

Learn more about the Electra Vector System and how it can benefit your research with this webinar featuring Medini Gore, Electra Project Manager.
View a pdf of webinar slides.


Vector Selector

Electra Cloning

The Electra system uses the type IIS restriction enzyme SapI. SapI recognizes a 7bp non-palindromic recognition sequence and cuts outside of the recognition sequence, leaving a 3bp 5’ overhang after digestion. ORFs in a pMOTHER vector can be excised with SapI, resulting in ATG and GGT overhangs. Alternatively, PCR can be used to generate ORFs with the correct overhangs. These ORFs can then be easily cloned into pDAUGHTER vectors, which are provided linearized with the corresponding overhangs.

pMOTHER type IIs sites

Electra System pMOTHER cloning ends

 

 

pDAUGHTER Overhangs (linearized vector)

Electra System pDAUGHTER cloning ends

pDAUGHTER vectors are provided linearized with compatible ends, and do NOT contain SapI sites.


Electra Protocol

Component Volume (µl)
Total Volume 20
Mother Vector DNA or PCR product (20 ng final) 1
Daughter Vector (20 ng final) 1
Electra Buffer Mix* (1X) 2
Electra Enzyme Mix* (1X) 1
Sterile ddH2O 15
*From the Electra Cloning Kit
  1. Combine components as listed in table above in a single 1.5ml tube. Note Daughter Vectors come pre-linearized from DNA2.0.
  2. Incubate 5 – 20 minutes at room temperature.
  3. Transform 2 µl of each reaction into competent cells. Note cells used at DNA2.0 are streptomycin resistant cell lines.
  4. Plate onto LB plates with selection antibiotic alone,
    or with selection antibiotic and 100 µg/mL streptomycin (Teknova #L1148 Kan+strep, Streptomycin resistant strain such as DH10B is recommended if using pMother with rpsL counter-selection),
    or YEG plates with selection antibiotic and 16mM p-chloro-phenylalanine (Teknova #Y5700 (Kan+chloro-phe) or #Y5705 (Amp+chloro-phe)). (Protocol for making pheS or rpsL plates)
  5. Incubate overnight at 37°C.

PCR Your ORF

We recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into Electra vectors. Add 15-20 bp of your ORF to the 3′ primer end to amplify your ORF and have it compatible with any of the Electra MOTHER or Electra DAUGHTER expression vectors.

  • Forward primer with ATG start codon on primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTATG….(ORF beginning after ATG start codon)….
  • Reverse primer:
    5′-TAGGTACGAACTCGATTGACGGCTCTTCTACC….(ORF Reverse Complement)….

Additional Info

A PCR mixture can be directly cloned into pMOTHER or pDAUGHTER vectors using the Electra reagents. However, if your PCR reaction shows multiple bands by gel analysis, it is very likely that some fragments other than your gene of interest will also contain SapI ends and may be cloned into your Electra vector. Additional screening of colonies will be useful to identify clones containing your gene of interest.

Your ORF must NOT contain any SapI recognition sites, as the Electra cloning process utilizes the type IIs enzyme SapI

pD and pM vectors (without an ORF) are provided as linearized DNA in solution (10 reactions). pD or pM vectors with a control ORF are provided as circular plasmids (lyophilized).

Use the DNA2.0 Bioinformatics Toolbox to facilitate primer analysis and design.

A PDF of this protocol can be found here.PDF image
A PDF to make PheS or rpsL plates can be found here.PDF image

Time Course: Gene transfer from pMOTHER to pDAUGHTER vectors

To determine the time course and selectivity of a standard Electra reaction.

  • pMOTHER constructs: a yellow fluorescent protein gene (KringleYFP) was cloned into two pMOTHER vectors:
    1. pMOTHER264 – pUC bacterial origin, Amp resistance, rpsL counter-selection marker
    2. pMOTHER268 – pUC bacterial origin, Amp resistance, PheS counter-selection marker
  • SapI-linearized pDAUGHTER vector:
    &nbsp pDAUGHTER 441-SR (inducible T5 promoter, strong RBS, Kan resistance, pUC bacterial origin)

Methods:

  1. Reactions for the exchange of ORF from pMOTHER vectors to pDAUGHTER vector were set up in a single 1.5ml tube as follows:
    Component Volume (µl)
    Total Volume 20
    Mother Vector (30ng final) 3
    Daughter Vector (3 ng final) 1
    Electra Buffer Mix (1X) 2
    Electra Enzyme Mix (1X) 1
    ddH2O 13
  2. Reactions were incubated for 5, 10, 20, 40 or 60 minutes at room temperature.
  3. 2.5 µl of each reaction was transformed into 50 µl of NEB 10-beta Competent E. coli and 100 µl of each transformation was plated onto LB Agar plates with 30 µg/mL kanamycin alone or with kanamycin and 100 µg/mL streptomycin or YEG (phenylalanine analog).
  4. 48 transformants were picked from both the kanamycin alone and kanamycin + streptomycin or chloro –phenylalanine plates for each of the MOTHER/DAUGHTER combinations and sequence verified. Greater than 95% of the transformants had the correct insert.

Results:

Time Course of Electra reaction:
CFU/100µl 1:100 dilution plated
LB+Kan
CFU/100µl 1:100 dilution plated
LB+Kan+Strep         YEG+kan+chloro-phe
Time pM264 x pDAUGHTER (T5) pM268 x pDAUGHTER (T5) pM264 x pDAUGHTER (T5) pM264 x pDAUGHTER (T5)
5min 35 18 39 21
10min 87 67 115 68
20min 252 202 332 222
40min 423 381 432 421
60min 383 367 380 363
Electra System Time Course

Electra system cloning time course with E. coli pDAUGHTER expression vectors. A gene encoding KringleYFP was cloned into an ampicillin-resistant pMOTHER vector with an rpsL counter-selection gene (pMOTHER264, left panel) or a PheS counter-selection gene (pMOTHER268, right panel). The pMOTHER vectors were mixed with a pre-linearized E. coli pDAUGHTER expression vector with inducible T5 promoter (pDAUGHTER441-SR) in the presence of SapI, T4 DNA ligase and ATP. Reaction mixtures were transformed into E. coli NEB 10-beta Competent E. coli cells after various reaction times, and plated onto nutrient agar with kanamycin (blue lines) or kanamycin plus MOTHER counter-selection agent (red lines).

These results show that incubation of MOTHER DNA, DAUGHTER DNA, type IIs restriction enzyme SapI and T4 DNA ligase in a single tube results in the exchange and stable propagation of the yellow fluorescent protein fragment from the pMOTHER vector to the pDAUGHTER vector in as little as 5 minutes and the reaction is complete by 40 min at 25°C.

Summary:

A pMOTHER vector carrying a gene encoding KringleYFP (yellow fluorescent protein) was mixed with an E. coli expression pDAUGHTER vector in the presence of Electra Reagent Mix for between 5 and 60 minutes. Reactions were transformed into competent cells and plated onto LB agar plates supplemented with appropriate selective antibiotics.

Reactions give transformants in as little as 5 minutes and are complete by 40 minutes. Almost all transformants showed an inducible fluorescent yellow phenotype, indicating accurate movement of the gene from the pMOTHER into the expression pDAUGHTER vectors. DAUGHTER constructs are selected because MOTHER and DAUGHTER vectors use different antibiotic resistance markers.

Since MOTHER and DAUGHTER are present in the transformation mixture, a fraction of the cells transformed with a DAUGHTER construct will also take up and maintain the MOTHER construct. MOTHER vectors therefore also carry a counter-selection marker, either rpsL (streptomycin sensitivity) or PheS (phenylalanine analog p-chlorophenylalanine sensitivity). Plating transformants onto media that contains both DAUGHTER selection antibiotic and MOTHER counter-selection agent reduces (rpsL) or completely eliminates (PheS) transformants that carry the MOTHER.


Cloning of PCR product into an Electra pDAUGHTER vector

To determine if it is possible to clone a PCR product without any prior treatment or cleanup, into a pDAUGHTER vector using the Electra one tube reaction approach described above.

Methods:

  1. A yellow fluorescent protein (KringleYFP) was amplified by PCR using primers:
    107888A-ampF
    TACACGTACTTAGTCGCTGAAGGGGAAGTCTTCGCTCTTCTATGACGGCACTGACTGAAGGCGCAAAACTGTTCGAG
    107888A-ampR
    AGGTACGAACTCGATTGACGTTTTTAGTCTTCGCTCTTCTACCTTAACGGTACGTTTCCAGGTCAACTGCCTTGATC
  2. 5 µl of each reaction was run on a 1% agarose-TBE gel. A strong and clean amplicon running at 750 bp was observed with an estimated concentration of 100ng/µl.
  3. Electra cloning of PCR product into a pDAUGHTER vector was carried out as a one tube reaction using 2 ng of linearized pDAUGHTER vector, 200 ng of PCR reaction and incubation time of 5 minutes at room temperature.
  4. 2.5 µl of each reaction was transformed into 50 µl of NEB 10-beta Competent E. coli and 100 µl of each transformation was plated.

Results:

We observed thousands of yellow colonies with less than 5% white colonies with no insert. The results demonstrate that crude PCR product can be cloned into a pDAUGHTER vector in 5 minutes at room temperature without any PCR reaction treatment or cleanup. It will therefore be possible to PCR amplify a gene of interest and efficiently clone the PCR product into any DAUGHTER vector. PCR allows for efficient transfer of an open reading frame of interest into a variety of host expression systems using the Electra cloning system and DNA2.0’s DAUGHTER expression vectors.


Expression of Cutinase in pD441 Electra Vector with Various Secretion Signals

To determine expression levels from a variety of E. coli secretion signals using Electra daughter vectors. This experiment shows that it is simple and effective to transfer an ORF from a single mother vector into multiple daughter vectors, allowing one to compare and optimize expression levels.

Figure: Expression of Cutinase in pD441 Electra Vector with Various Secretion Signals

Figure: Expression of Cutinase in pD441 Electra Vector with Various Secretion Signals.  Four transformants per construct in E. coli BL21 cells were grown at 37°C in 2 ml LB + 30 µg/ml kanamycin to an OD600 of 0.8.  Cultures were induced by addition of 1mM IPTG and incubated for 3 hrs at 37°C; uninduced cultures were run as negative controls.  Samples were pelleted and periplamic preps prepared.  Total protein samples and periplasmic fractions were denatured and reduced in sample buffer with reducing agent at 95°C for 10min.  5µl of denatured sample was loaded per lane of a 4-12% NuPAGE Bis-Tris MES gel and Coomasie stained.  As observed from the gels (panels A, B and C), there are clear differences in expression and processing of the cutinase protein with different secretion signals seen in the periplasmic fractions (shown by arrows).  The highest expression levels of cutinase in the periplasmic fractions were observed with secretion signal mal (panel C, left) with no uncleaved higher mol. wt. bands.  Secretion signals pelB (panel A, right) and ompA (panel B, right) showed lower levels of cutinase expression with some higher mol. wt. bands indicating incomplete processing.

“Electra-fy” Your Vector

DNA2.0 can modify almost any cloning or expression vector into an Electra Vector. Your favorite vector can then be used with the Electra system to quickly and efficiently transfer genes. Of course, your vectors remain your property, and the entire system is IP-Free.

Consult with an Electra Specialist today at +1 877 362 8646 or info@DNA20.com to learn more about improving your cloning and expression system.

“Nothing like adding a little more tragedy to science!” – Dr. Aaron Straight, Stanford University

True, science can occasionally feel like a Greek tragedy. We named our new cloning system ‘Electra’ because it allows you to select against the pMOTHER vector just as Electra destroyed her own mother Clytemnestra. Hopefully, your endeavours are more successful than those of Antigone. Thankfully, unlike the original Electra, your selection of the daughter against the mother will not require any atonement to the gods.

Learn more about the classic Greek tragedy Electra:
Electra story – Euripedes version
Electra story – Sophocles version

DNA2.0 has created a line of products designated “IP-Free”. These products do not require any licensing, do not have royalty shares and do not have restrictions on downstream use. Sure, our lawyers put in a bit of reasonable legal fine print (you can’t resell the exact same product, you can’t use it for direct competition, you have to give us some acknowledgement, etc…); but other than that, we really do mean that these products are completely IP-Free. For example, you can use them in your research or create products to which you own all the rights.
See the complete legal IP-Free Terms and Conditions
DNA2.0 has patent applications filed for the Electra cloning system using the type IIs enzyme SapI, and holds all rights for the system.
Yes! See the protocol for all the necessary info, including primers and design. You can clone your PCR product into any pMOTHER or pDAUGHTER vector.

To PCR your ORF: we recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into Electra vectors. Add 15-20 bp of your ORF to the 3′ primer end to amplify your ORF and have it compatible with any of the Electra MOTHER or Electra DAUGHTER expression vectors.

  • Forward primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTATG….(ORF)….
  • Reverse primer:
    5′-AGGTACGAACTCGATTGACGGCTCTTCTACC….(ORF Reverse Complement)….

Use the DNA2.0 Bioinformatics Toolbox to facilitate primer analysis and design.

Your ORF must NOT contain any SapI recognition sites, as the Electra cloning process utilizes the type IIs enzyme SapI

Easy, simply PCR out your ORF using the PCR primer ends shown below and clone into any Electra vector using the standard protocol.

To PCR your ORF we recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into Electra vectors. Add 15-20 bp of your ORF to the 3′ primer end to amplify your ORF and have it compatible with any of the Electra MOTHER or Electra DAUGHTER expression vectors.

  • Forward primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTATG….(ORF)….
  • Reverse primer:
    5′-AGGTACGAACTCGATTGACGGCTCTTCTACC….(ORF Reverse Complement)….

Use the DNA2.0 Bioinformatics Toolbox to facilitate primer analysis and design.

Your ORF must NOT contain any SapI recognition sites, as the Electra cloning process utilizes the type IIs enzyme SapI

Yes! You can use the Electra reagents kit for all Electra cloning reactions.
Easy, DNA2.0 can modify almost any cloning or expression vector into an Electra Vector. Your favorite vector can then be used with the Electra system to quickly and efficiently transfer genes. Of course, your vectors remain your property, and the entire system is IP-Free.

Consult with an Electra Specialist today at +1 877 362 8646 or info@DNA20.com to learn more about improving your cloning and expression system.

Electra System Vectors are available for all customers worldwide.

Note, the Electra Vector System reagents kit ships on ice, and is currently available to ship only to customers in the US, Canada, Japan, and major European hubs.
Electra System international shipping is available to European locations from our EU distributor, Cambridge Bioscience, Ltd.
Electra System international shipping is available to Japanese locations from our distributor, Cosmo Bio Co, Ltd.

Yes.

A PDF to make PheS or rpsL plates can be found here.PDF image

You can also order plates from Teknova:
Selection antibiotic and 100 µg/mL streptomycin (Teknova #L1148 Kan+strep, Streptomycin resistant strain such as DH10B is recommended if using pMother with rpsL counter-selection. )
YEG plates with selection antibiotic and 16mM p-chloro-phenylalanine (Teknova #Y5700 (Kan+chloro-phe) or #Y5705 (Amp+chloro-phe))